1qwa
From Proteopedia
(Difference between revisions)
Line 1: | Line 1: | ||
==NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.== | ==NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.== | ||
- | <StructureSection load='1qwa' size='340' side='right' caption='[[1qwa]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> | + | <StructureSection load='1qwa' size='340' side='right'caption='[[1qwa]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> |
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWA FirstGlance]. <br> | <table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=1QWA FirstGlance]. <br> | ||
Line 20: | Line 20: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
+ | [[Category: Large Structures]] | ||
[[Category: Feigon, J]] | [[Category: Feigon, J]] | ||
[[Category: Finger, L D]] | [[Category: Finger, L D]] |
Revision as of 11:40, 4 December 2019
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
|
Categories: Large Structures | Feigon, J | Finger, L D | Johansson, C | Trantirek, L | A-form helix | Bulged nucleotide | Hairpin | Rna | Tetraloop | Uncg | Uucg | Ynmg