2mo6

From Proteopedia

proteopedia linkproteopedia link

Revision as of 10:46, 30 April 2015 (edit) OCA (Talk | contribs) ← Previous diff		Revision as of 05:03, 24 June 2020 (edit) (undo) OCA (Talk | contribs) Next diff →
Line 1:		Line 1:
-	WITHDRAWN: The PDB entry 2MO6 was withdrawn.	+	'''Unreleased structure'''
		+
		+	The entry 2mo6 is ON HOLD
		+
		+	Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
		+
		+	Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
		+	[[Category: Unreleased Structures]]
		+	[[Category: Karsisiotis, A.I]]
		+	[[Category: Dvorkin, S.A]]
		+	[[Category: Webba Da Silva, M]]

---

Revision as of 05:03, 24 June 2020

Unreleased structure

The entry 2mo6 is ON HOLD

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution