We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2mo6

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
-
WITHDRAWN: The PDB entry 2MO6 was withdrawn.
+
'''Unreleased structure'''
 +
 
 +
The entry 2mo6 is ON HOLD
 +
 
 +
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
 +
 
 +
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
 +
[[Category: Unreleased Structures]]
 +
[[Category: Karsisiotis, A.I]]
 +
[[Category: Dvorkin, S.A]]
 +
[[Category: Webba Da Silva, M]]

Revision as of 05:03, 24 June 2020

Unreleased structure

The entry 2mo6 is ON HOLD

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools