1qwa
From Proteopedia
(Difference between revisions)
Line 3: | Line 3: | ||
<StructureSection load='1qwa' size='340' side='right'caption='[[1qwa]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> | <StructureSection load='1qwa' size='340' side='right'caption='[[1qwa]], [[NMR_Ensembles_of_Models | 17 NMR models]]' scene=''> | ||
== Structural highlights == | == Structural highlights == | ||
- | <table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [ | + | <table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br> |
- | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[1f7y|1f7y]], [[1jp0|1jp0]], [[1f7f|1f7f]], [[1qwb|1qwb]]</td></tr> | + | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat"><div style='overflow: auto; max-height: 3em;'>[[1f7y|1f7y]], [[1jp0|1jp0]], [[1f7f|1f7f]], [[1qwb|1qwb]]</div></td></tr> |
- | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[ | + | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr> |
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> |
Revision as of 06:57, 7 April 2021
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
|
Categories: Large Structures | Feigon, J | Finger, L D | Johansson, C | Trantirek, L | A-form helix | Bulged nucleotide | Hairpin | Rna | Tetraloop | Uncg | Uucg | Ynmg