5dtd

From Proteopedia

(Difference between revisions)

Revision as of 11:25, 23 March 2022

Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

Structural highlights

5dtd is a 4 chain structure with sequence from Ecoli. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance.
Gene:	fis, b3261, JW3229 (ECOLI)
Resources:	FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT

Function

[FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.^[1] ^[2]

Publication Abstract from PubMed

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequences in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. The affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.

DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.,Hancock SP, Stella S, Cascio D, Johnson RC PLoS One. 2016 Mar 9;11(3):e0150189. doi: 10.1371/journal.pone.0150189., eCollection 2016. PMID:26959646^[3]

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.

References

↑ Ross W, Thompson JF, Newlands JT, Gourse RL. E.coli Fis protein activates ribosomal RNA transcription in vitro and in vivo. EMBO J. 1990 Nov;9(11):3733-42. PMID:2209559
↑ Wold S, Crooke E, Skarstad K. The Escherichia coli Fis protein prevents initiation of DNA replication from oriC in vitro. Nucleic Acids Res. 1996 Sep 15;24(18):3527-32. PMID:8836178
↑ Hancock SP, Stella S, Cascio D, Johnson RC. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. PLoS One. 2016 Mar 9;11(3):e0150189. doi: 10.1371/journal.pone.0150189., eCollection 2016. PMID:26959646 doi:http://dx.doi.org/10.1371/journal.pone.0150189

1 Structural highlights
2 Function
3 Publication Abstract from PubMed
4 See Also
5 References

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/5dtd"

@@ Line 3: / Line 3: @@
 <StructureSection load='5dtd' size='340' side='right'caption='[[5dtd]], [[Resolution|resolution]] 2.64&Aring;' scene=''>
 == Structural highlights ==
-<table><tr><td colspan='2'>[[5dtd]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DTD OCA]. For a <b>guided tour on the structure components</b> use [http://proteopedia.org/fgij/fg.htm?mol=5DTD FirstGlance]. <br>
+<table><tr><td colspan='2'>[[5dtd]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DTD OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5DTD FirstGlance]. <br>
-</td></tr><tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">fis, b3261, JW3229 ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr>
+</td></tr><tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">fis, b3261, JW3229 ([https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr>
-<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://proteopedia.org/fgij/fg.htm?mol=5dtd FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5dtd OCA], [http://pdbe.org/5dtd PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5dtd RCSB], [http://www.ebi.ac.uk/pdbsum/5dtd PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5dtd ProSAT]</span></td></tr>
+<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5dtd FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5dtd OCA], [https://pdbe.org/5dtd PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5dtd RCSB], [https://www.ebi.ac.uk/pdbsum/5dtd PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5dtd ProSAT]</span></td></tr>
 </table>
 == Function ==
-[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
+[[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
 <div style="background-color:#fffaf0;">
 == Publication Abstract from PubMed ==

5dtd

From Proteopedia

Revision as of 11:25, 23 March 2022

Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

Structural highlights

Function

Publication Abstract from PubMed

See Also

References

Contents

Proteopedia Page Contributors and Editors (what is this?)

Views

Personal tools

Navigation

Search

Toolbox