This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


5e3n

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 3: Line 3:
<StructureSection load='5e3n' size='340' side='right'caption='[[5e3n]], [[Resolution|resolution]] 2.66&Aring;' scene=''>
<StructureSection load='5e3n' size='340' side='right'caption='[[5e3n]], [[Resolution|resolution]] 2.66&Aring;' scene=''>
== Structural highlights ==
== Structural highlights ==
-
<table><tr><td colspan='2'>[[5e3n]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3N OCA]. For a <b>guided tour on the structure components</b> use [http://proteopedia.org/fgij/fg.htm?mol=5E3N FirstGlance]. <br>
+
<table><tr><td colspan='2'>[[5e3n]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3N OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5E3N FirstGlance]. <br>
-
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3o|5e3o]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr>
+
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat"><div style='overflow: auto; max-height: 3em;'>[[5e3l|5e3l]], [[5e3o|5e3o]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</div></td></tr>
-
<tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">fis, b3261, JW3229 ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr>
+
<tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">fis, b3261, JW3229 ([https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr>
-
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://proteopedia.org/fgij/fg.htm?mol=5e3n FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3n OCA], [http://pdbe.org/5e3n PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3n RCSB], [http://www.ebi.ac.uk/pdbsum/5e3n PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3n ProSAT]</span></td></tr>
+
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5e3n FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3n OCA], [https://pdbe.org/5e3n PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5e3n RCSB], [https://www.ebi.ac.uk/pdbsum/5e3n PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3n ProSAT]</span></td></tr>
</table>
</table>
== Function ==
== Function ==
-
[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
+
[[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
== Publication Abstract from PubMed ==

Revision as of 11:25, 23 March 2022

Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

PDB ID 5e3n

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools