This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
4ihv
From Proteopedia
(Difference between revisions)
| Line 1: | Line 1: | ||
==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | ==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | ||
| - | <StructureSection load='4ihv' size='340' side='right' caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> | + | <StructureSection load='4ihv' size='340' side='right'caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> |
== Structural highlights == | == Structural highlights == | ||
| - | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [ | + | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br> |
| - | </td></tr> | + | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> |
| - | + | ||
| - | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[ | + | |
</table> | </table> | ||
| - | == Function == | ||
| - | [[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166] | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
== Publication Abstract from PubMed == | == Publication Abstract from PubMed == | ||
| Line 26: | Line 22: | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
| - | [[Category: | + | [[Category: Escherichia coli K-12]] |
| - | [[Category: | + | [[Category: Large Structures]] |
| - | [[Category: | + | [[Category: Cascio D]] |
| - | [[Category: | + | [[Category: Hancock SP]] |
| - | [[Category: | + | [[Category: Johnson RC]] |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
Revision as of 20:46, 16 November 2022
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
| |||||||||||
