|
|
| Line 1: |
Line 1: |
| | | | |
| | ==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | | ==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== |
| - | <StructureSection load='4ihv' size='340' side='right' caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> | + | <StructureSection load='4ihv' size='340' side='right'caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> |
| | == Structural highlights == | | == Structural highlights == |
| - | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4IHV FirstGlance]. <br> | + | <table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br> |
| - | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[4ihw|4ihw]], [[4ihx|4ihx]], [[4ihy|4ihy]]</td></tr> | + | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> |
| - | <tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">ECDH1ME8569_3147, EcDH1_0445, fis ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr>
| + | |
| - | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [http://pdbe.org/4ihv PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [http://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> | + | |
| | </table> | | </table> |
| - | == Function == | |
| - | [[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166] | |
| | <div style="background-color:#fffaf0;"> | | <div style="background-color:#fffaf0;"> |
| | == Publication Abstract from PubMed == | | == Publication Abstract from PubMed == |
| Line 26: |
Line 22: |
| | __TOC__ | | __TOC__ |
| | </StructureSection> | | </StructureSection> |
| - | [[Category: Ecoli]] | + | [[Category: Escherichia coli K-12]] |
| - | [[Category: Cascio, D]] | + | [[Category: Large Structures]] |
| - | [[Category: Hancock, S P]] | + | [[Category: Cascio D]] |
| - | [[Category: Johnson, R C]] | + | [[Category: Hancock SP]] |
| - | [[Category: Dna bending]] | + | [[Category: Johnson RC]] |
| - | [[Category: Hth domain]]
| + | |
| - | [[Category: Indirect recognition]]
| + | |
| - | [[Category: Minor groove compression]]
| + | |
| - | [[Category: Protein-dna complex]]
| + | |
| - | [[Category: Transcription-dna complex]]
| + | |
| Structural highlights
Publication Abstract from PubMed
The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes.
Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.,Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC Nucleic Acids Res. 2013 May 9. PMID:23661683[1]
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.
See Also
References
- ↑ Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 May 9. PMID:23661683 doi:10.1093/nar/gkt357
|
