1qwa
From Proteopedia
(Difference between revisions)
Line 1: | Line 1: | ||
==NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.== | ==NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.== | ||
- | <StructureSection load='1qwa' size='340' side='right'caption='[[1qwa | + | <StructureSection load='1qwa' size='340' side='right'caption='[[1qwa]]' scene=''> |
== Structural highlights == | == Structural highlights == | ||
- | <table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br> | + | <table><tr><td colspan='2'>[[1qwa]] is a 1 chain structure with sequence from [https://en.wikipedia.org/wiki/Mus_musculus Mus musculus]. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1QWA OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1QWA FirstGlance]. <br> |
- | </td></tr> | + | </td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr> |
- | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1qwa FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1qwa OCA], [https://pdbe.org/1qwa PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1qwa RCSB], [https://www.ebi.ac.uk/pdbsum/1qwa PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1qwa ProSAT]</span></td></tr> | + | |
</table> | </table> | ||
<div style="background-color:#fffaf0;"> | <div style="background-color:#fffaf0;"> | ||
Line 21: | Line 20: | ||
</StructureSection> | </StructureSection> | ||
[[Category: Large Structures]] | [[Category: Large Structures]] | ||
- | [[Category: Feigon | + | [[Category: Mus musculus]] |
- | [[Category: Finger | + | [[Category: Feigon J]] |
- | [[Category: Johansson | + | [[Category: Finger LD]] |
- | [[Category: Trantirek | + | [[Category: Johansson C]] |
- | + | [[Category: Trantirek L]] | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + |
Revision as of 08:06, 11 January 2023
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
|