9pz7

From Proteopedia

(Difference between revisions)
Jump to: navigation, search

OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 9pz7 is ON HOLD Authors: Werther, R., Stoddard, B.L. Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACT...)
Next diff →

Revision as of 04:54, 20 August 2025

Unreleased structure

The entry 9pz7 is ON HOLD

Authors: Werther, R., Stoddard, B.L.

Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/9pz7"
Personal tools