9pz7

From Proteopedia

Revision as of 04:54, 20 August 2025 (edit) OCA (Talk | contribs) (New page: '''Unreleased structure''' The entry 9pz7 is ON HOLD Authors: Werther, R., Stoddard, B.L. Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACT...) ← Previous diff

Revision as of 04:54, 20 August 2025 (edit) (undo) OCA (Talk | contribs) m (Protected "9pz7" [edit=sysop:move=sysop]) Next diff →

---

Revision as of 04:54, 20 August 2025

proteopedia linkproteopedia link

Unreleased structure

The entry 9pz7 is ON HOLD

Authors: Werther, R., Stoddard, B.L.

Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA