We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
9yzk
From Proteopedia
(Difference between revisions)
OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 9yzk is ON HOLD Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Description: Isoreticular co-crystal 1 with symmetrical expanded d...)
Next diff →
Revision as of 08:30, 6 November 2025
Unreleased structure
The entry 9yzk is ON HOLD
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
