We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

9yzk

From Proteopedia

(Difference between revisions)
Jump to: navigation, search

OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 9yzk is ON HOLD Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Description: Isoreticular co-crystal 1 with symmetrical expanded d...)
Next diff →

Revision as of 08:30, 6 November 2025

Unreleased structure

The entry 9yzk is ON HOLD

Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools