9yzk

From Proteopedia

Revision as of 08:30, 6 November 2025 (edit) OCA (Talk | contribs) (New page: '''Unreleased structure''' The entry 9yzk is ON HOLD Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Description: Isoreticular co-crystal 1 with symmetrical expanded d...) ← Previous diff

Revision as of 08:30, 6 November 2025 (edit) (undo) OCA (Talk | contribs) m (Protected "9yzk" [edit=sysop:move=sysop]) Next diff →

---

Revision as of 08:30, 6 November 2025

proteopedia linkproteopedia link

Unreleased structure

The entry 9yzk is ON HOLD

Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA