We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

9yzk

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
m (Protected "9yzk" [edit=sysop:move=sysop])
Current revision (17:55, 4 December 2025) (edit) (undo)
 
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''
-
The entry 9yzk is ON HOLD
+
The entry 9yzk is ON HOLD until Paper Publication
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Line 7: Line 7:
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
[[Category: Unreleased Structures]]
[[Category: Unreleased Structures]]
 +
[[Category: Slaughter, C.K]]
 +
[[Category: Shields, E.T]]
[[Category: Snow, C.D]]
[[Category: Snow, C.D]]
[[Category: Magna, E.N]]
[[Category: Magna, E.N]]
-
[[Category: Shields, E.T]]
 
-
[[Category: Slaughter, C.K]]
 

Current revision

Unreleased structure

The entry 9yzk is ON HOLD until Paper Publication

Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools