We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
9yzk
From Proteopedia
(Difference between revisions)
m (Protected "9yzk" [edit=sysop:move=sysop]) |
|||
| Line 1: | Line 1: | ||
'''Unreleased structure''' | '''Unreleased structure''' | ||
| - | The entry 9yzk is ON HOLD | + | The entry 9yzk is ON HOLD until Paper Publication |
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | ||
| Line 7: | Line 7: | ||
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | ||
[[Category: Unreleased Structures]] | [[Category: Unreleased Structures]] | ||
| + | [[Category: Slaughter, C.K]] | ||
| + | [[Category: Shields, E.T]] | ||
[[Category: Snow, C.D]] | [[Category: Snow, C.D]] | ||
[[Category: Magna, E.N]] | [[Category: Magna, E.N]] | ||
| - | [[Category: Shields, E.T]] | ||
| - | [[Category: Slaughter, C.K]] | ||
Current revision
Unreleased structure
The entry 9yzk is ON HOLD until Paper Publication
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
