User:Wayne Decatur/I-Ppo Morph Methods

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(New page: Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) us...)
Line 1: Line 1:
-
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. I deleted the two 'A's at the three prime end of both strand to get like in structure.
+
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in [[Lac repressor morph methods]]. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate like in structure.
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or

Revision as of 06:44, 30 December 2008

Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in Lac repressor morph methods. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate like in structure.

In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or

Proteopedia Page Contributors and Editors (what is this?)

Wayne Decatur

Personal tools