3iv5
From Proteopedia
(Difference between revisions)
OCA (Talk | contribs)
(New page: '''Unreleased structure''' The entry 3iv5 is ON HOLD until sometime in the future Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C. Description: Crystal structure of Fis bound...)
Next diff →
Revision as of 06:08, 9 September 2009
Unreleased structure
The entry 3iv5 is ON HOLD until sometime in the future
Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C.
Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)
Page seeded by OCA on Wed Sep 9 09:08:12 2009
