4ihv
From Proteopedia
Contents |
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Template:ABSTRACT PUBMED 23661683
Function
[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
About this Structure
4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.
Reference
- Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 May 9. PMID:23661683 doi:10.1093/nar/gkt357
