2m90

From Proteopedia

Revision as of 15:41, 10 July 2013 by OCA (Talk | contribs)
Jump to: navigation, search

Template:STRUCTURE 2m90

Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid

Template:ABSTRACT PUBMED 23794476

About this Structure

2m90 is a 1 chain structure. Full experimental information is available from OCA.

Reference

  • Lim KW, Phan AT. Structural Basis of DNA Quadruplex-Duplex Junction Formation. Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 doi:10.1002/anie.201302995

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools