We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
2mo6
From Proteopedia
Unreleased structure
The entry 2mo6 is ON HOLD
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
