9yzk

From Proteopedia

Revision as of 08:30, 6 November 2025 by OCA (Talk | contribs)
Jump to: navigation, search

Unreleased structure

The entry 9yzk is ON HOLD

Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools