This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


3iv5

From Proteopedia

Revision as of 06:59, 30 September 2009 by OCA (Talk | contribs)
Jump to: navigation, search

Unreleased structure

The entry 3iv5 is ON HOLD

Authors: Stella, S., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)

Page seeded by OCA on Wed Sep 30 08:59:19 2009

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools