1qwa

From Proteopedia

Revision as of 05:13, 29 July 2008 by OCA (Talk | contribs)
Jump to: navigation, search
Image:1qwa.png

Template:STRUCTURE 1qwa

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

Template:ABSTRACT PUBMED 14602904

About this Structure

1QWA is a Single protein structure. Full experimental information is available from OCA.

Reference

Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin., Finger LD, Trantirek L, Johansson C, Feigon J, Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904

Page seeded by OCA on Tue Jul 29 08:13:30 2008

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/1qwa"
Personal tools