1qwb
From Proteopedia
NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
Template:ABSTRACT PUBMED 14602904
About this Structure
Full experimental information is available from OCA.
Reference
Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin., Finger LD, Trantirek L, Johansson C, Feigon J, Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904
Page seeded by OCA on Mon Jul 28 10:48:43 2008
