4ihv

From Proteopedia

Revision as of 08:59, 2 January 2013 by OCA (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Unreleased structure

The entry 4ihv is ON HOLD

Authors: Hancock, Stephen P., Cascio, Duilio, Johnson, Reid C.

Description: Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools