2mo6

Revision as of 12:13, 24 December 2014 by OCA (Talk | contribs)

Unreleased structure

The entry 2mo6 is ON HOLD until sometime in the future

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution

Proteopedia Page Contributors and Editors (what is this?)