5e3n

From Proteopedia

Revision as of 02:23, 1 December 2015 by OCA (Talk | contribs)
Jump to: navigation, search

Unreleased structure

The entry 5e3n is ON HOLD until Paper Publication

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools