1qwa

From Proteopedia

Revision as of 11:40, 4 December 2019 by OCA (Talk | contribs)
Jump to: navigation, search

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

PDB ID 1qwa

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools