3iv5

Revision as of 06:59, 30 September 2009 by OCA (Talk | contribs)

Unreleased structure

The entry 3iv5 is ON HOLD

Authors: Stella, S., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)

Page seeded by OCA on Wed Sep 30 08:59:19 2009

Proteopedia Page Contributors and Editors (what is this?)