We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
3iv5
From Proteopedia
Unreleased structure
The entry 3iv5 is ON HOLD
Authors: Stella, S., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)
Page seeded by OCA on Wed Sep 30 08:59:19 2009
