1qwa

From Proteopedia

Revision as of 02:21, 25 November 2007 by OCA (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

1qwa

Drag the structure with the mouse to rotate

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

Overview

Nucleolin, a multi-domain protein involved in ribosome biogenesis, has, been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of, a hairpin loop structure (nucleolin recognition element; NRE). Previous, studies have shown that the first two RNA-binding domains in nucleolin, (RBD12) are responsible for the interaction with the in vitro selected NRE, (sNRE). We have previously reported the structures of nucleolin RBD12, sNRE and nucleolin RBD12-sNRE complex. A comparison of free and bound sNRE, shows that the NRE loop becomes structured upon binding. From this, observation, we hypothesized that the disordered hairpin loop of sNRE, facilitates conformational rearrangements when the protein binds. Here, we, show that nucleolin RBD12 is also sufficient for sequence- specific, binding of two NRE sequences found in pre-rRNA, b1NRE and b2NRE., Structural investigations of the free NREs using NMR spectroscopy show, that the b1NRE loop is conformationally heterogeneous, while the b2NRE, loop is structured. The b2NRE forms a hairpin capped by a YNMG-like, tetraloop. Comparison of the chemical shifts of sNRE and b2NRE in complex, with nucleolin RBD12 suggests that the NRE consensus nucleotides adopt a, similar conformation. These results show that a disordered NRE consensus, sequence is not a prerequisite for nucleolin RBD12 binding.

About this Structure

1QWA is a Single protein structure of sequence from [1]. Full crystallographic information is available from OCA.

Reference

Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin., Finger LD, Trantirek L, Johansson C, Feigon J, Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904

Page seeded by OCA on Sun Nov 25 04:29:04 2007

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools