1qwa
From Proteopedia
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Template:ABSTRACT PUBMED 14602904
About this Structure
1qwa is a 1 chain structure. Full experimental information is available from OCA.
Reference
- Finger LD, Trantirek L, Johansson C, Feigon J. Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin. Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904
Categories: Feigon, J. | Finger, L D. | Johansson, C. | Trantirek, L. | A-form helix | Bulged nucleotide | Hairpin | Rna | Tetraloop | Uncg | Uucg | Ynmg