1qwb

From Proteopedia

Revision as of 15:45, 14 August 2012 by OCA (Talk | contribs)
Jump to: navigation, search
Image:1qwb.png

Template:STRUCTURE 1qwb

NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Template:ABSTRACT PUBMED 14602904

About this Structure

1qwb is a 1 chain structure. Full experimental information is available from OCA.

Reference

  • Finger LD, Trantirek L, Johansson C, Feigon J. Solution structures of stem-loop RNAs that bind to the two N-terminal RNA-binding domains of nucleolin. Nucleic Acids Res. 2003 Nov 15;31(22):6461-72. PMID:14602904

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/1qwb"
Personal tools