We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
4ihv
From Proteopedia
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Function
[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
About this Structure
4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.
