We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

4ihv

From Proteopedia

Revision as of 15:55, 19 June 2013 by OCA (Talk | contribs)
Jump to: navigation, search

Template:STRUCTURE 4ihv

Contents

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Template:ABSTRACT PUBMED 23661683

Function

[C9QXL3_ECOD1] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]

About this Structure

4ihv is a 4 chain structure with sequence from Escherichia coli k-12. Full crystallographic information is available from OCA.

Reference

  • Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 May 9. PMID:23661683 doi:10.1093/nar/gkt357

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools