This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2m93

From Proteopedia

Revision as of 15:44, 10 July 2013 by OCA (Talk | contribs)
Jump to: navigation, search

Template:STRUCTURE 2m93

Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid

Template:ABSTRACT PUBMED 23794476

About this Structure

2m93 is a 1 chain structure. Full experimental information is available from OCA.

Reference

  • Lim KW, Phan AT. Structural Basis of DNA Quadruplex-Duplex Junction Formation. Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 doi:10.1002/anie.201302995

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools