1qwb

From Proteopedia

Revision as of 19:25, 10 September 2015 by OCA (Talk | contribs)
Jump to: navigation, search

NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools