3qyn
From Proteopedia
Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair A/T Rich Response Element Containing 2 Base Pair Spacer Between Half Sites
Structural highlights
Disease[P63_HUMAN] Defects in TP63 are the cause of acro-dermato-ungual-lacrimal-tooth syndrome (ADULT syndrome) [MIM:103285]; a form of ectodermal dysplasia. Ectodermal dysplasias (EDs) constitute a heterogeneous group of developmental disorders affecting tissues of ectodermal origin. EDs are characterized by abnormal development of two or more ectodermal structures such as hair, teeth, nails and sweat glands, with or without any additional clinical sign. Each combination of clinical features represents a different type of ectodermal dysplasia. ADULT syndrome involves ectrodactyly, syndactyly, finger- and toenail dysplasia, hypoplastic breasts and nipples, intensive freckling, lacrimal duct atresia, frontal alopecia, primary hypodontia, and loss of permanent teeth. ADULT differs significantly from EEC3 syndrome by the absence of facial clefting. Defects in TP63 are the cause of ankyloblepharon-ectodermal defects-cleft lip/palate (AEC) [MIM:106260]. AEC is an autosomal dominant condition characterized by congenital ectodermal dysplasia with coarse, wiry, sparse hair, dystrophic nails, slight hypohidrosis, scalp infections, ankyloblepharon filiform adnatum, maxillary hypoplasia, hypodontia and cleft lip/palate.[1] Defects in TP63 are the cause of ectrodactyly-ectodermal dysplasia-cleft lip/palate syndrome type 3 (EEC3) [MIM:604292]. EEC3 is an autosomal dominant syndrome characterized by ectrodactyly of hands and feet, ectodermal dysplasia and facial clefting.[2] [3] [4] [5] Defects in TP63 are the cause of split-hand/foot malformation type 4 (SHFM4) [MIM:605289]. Split-hand/split-foot malformation is a limb malformation involving the central rays of the autopod and presenting with syndactyly, median clefts of the hands and feet, and aplasia and/or hypoplasia of the phalanges, metacarpals, and metatarsals. There is restricted overlap between the mutational spectra of EEC3 and SHFM4.[6] [7] Defects in TP63 are the cause of limb-mammary syndrome (LMS) [MIM:603543]. LMS is characterized by ectrodactyly, cleft palate and mammary-gland abnormalities.[8] Note=Defects in TP63 are a cause of cervical, colon, head and neck, lung and ovarian cancers. Defects in TP63 are a cause of ectodermal dysplasia Rapp-Hodgkin type (EDRH) [MIM:129400]; also called Rapp-Hodgkin syndrome or anhidrotic ectodermal dysplasia with cleft lip/palate. Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDRH is characterized by the combination of anhidrotic ectodermal dysplasia, cleft lip, and cleft palate. The clinical syndrome is comprised of a characteristic facies (narrow nose and small mouth), wiry, slow-growing, and uncombable hair, sparse eyelashes and eyebrows, obstructed lacrimal puncta/epiphora, bilateral stenosis of external auditory canals, microsomia, hypodontia, cone-shaped incisors, enamel hypoplasia, dystrophic nails, and cleft lip/cleft palate.[9] [10] [11] [12] Defects in TP63 are the cause of non-syndromic orofacial cleft type 8 (OFC8) [MIM:129400]. Non-syndromic orofacial cleft is a common birth defect consisting of cleft lips with or without cleft palate. Cleft lips are associated with cleft palate in two-third of cases. A cleft lip can occur on one or both sides and range in severity from a simple notch in the upper lip to a complete opening in the lip extending into the floor of the nostril and involving the upper gum. Function[P63_HUMAN] Acts as a sequence specific DNA binding transcriptional activator or repressor. The isoforms contain a varying set of transactivation and auto-regulating transactivation inhibiting domains thus showing an isoform specific activity. Isoform 2 activates RIPK4 transcription. May be required in conjunction with TP73/p73 for initiation of p53/TP53 dependent apoptosis in response to genotoxic insults and the presence of activated oncogenes. Involved in Notch signaling by probably inducing JAG1 and JAG2. Plays a role in the regulation of epithelial morphogenesis. The ratio of DeltaN-type and TA*-type isoforms may govern the maintenance of epithelial stem cell compartments and regulate the initiation of epithelial stratification from the undifferentiated embryonal ectoderm. Required for limb formation from the apical ectodermal ridge. Activates transcription of the p21 promoter.[13] [14] [15] [16] [17] [18] [19] Publication Abstract from PubMedTranscription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 muM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability. Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.,Chen C, Gorlatova N, Kelman Z, Herzberg O Proc Natl Acad Sci U S A. 2011 Apr 19;108(16):6456-6461. Epub 2011 Apr 4. PMID:21464285[20] From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine. See AlsoReferences
| ||||||||||||||||||||||
