We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

2mo6

From Proteopedia

Revision as of 05:03, 24 June 2020 by OCA (Talk | contribs)
Jump to: navigation, search

Unreleased structure

The entry 2mo6 is ON HOLD

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools