This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
2mo6
From Proteopedia
Unreleased structure
The entry 2mo6 is ON HOLD
Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.
Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution
