This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


2mo6

From Proteopedia

Revision as of 05:03, 24 June 2020 by OCA (Talk | contribs)
Jump to: navigation, search

Unreleased structure

The entry 2mo6 is ON HOLD

Authors: Webba da Silva, M., Dvorkin, S.A., Karsisiotis, A.I.

Description: G-quadruplex solution structure formed by the sequence d(GGGTTTTGGGTTTTGGGAGGG) in sodium solution

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools