1qwa

From Proteopedia

Revision as of 06:34, 1 May 2024 by OCA (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

PDB ID 1qwa

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "http://52.214.119.220/wiki/index.php/1qwa"
Personal tools