We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

9pz7

From Proteopedia

Revision as of 04:54, 20 August 2025 by OCA (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Unreleased structure

The entry 9pz7 is ON HOLD

Authors: Werther, R., Stoddard, B.L.

Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools