We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
9pz7
From Proteopedia
Unreleased structure
The entry 9pz7 is ON HOLD
Authors: Werther, R., Stoddard, B.L.
Description: Engineered variant of I-OnuI meganuclease to target DNA sequence TTTCCACTTATTCACTATTTTA
