We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

9yzk

From Proteopedia

Revision as of 17:55, 4 December 2025 by OCA (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Unreleased structure

The entry 9yzk is ON HOLD until Paper Publication

Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools