User:Wayne Decatur/I-Ppo Morph Methods

From Proteopedia

Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in Lac repressor morph methods. I deleted the two 'A's at the three prime end of both strand to get like in structure.

In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or