User:Wayne Decatur/I-Ppo Morph Methods

From Proteopedia

Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in Lac repressor morph methods. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends line in the 1a73 structure.

In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go.