This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.
User:Wayne Decatur/I-Ppo Morph Methods
From Proteopedia
Generated straight B-form DNA of homing site used in structure (TTGACTCTCTTAAGAGAGTCAA [extra 'A' at 3' end for getting two T's on both strands since you only enter text for one strand) using Model It as described in Lac repressor morph methods. Editing text of the pdb file, I deleted the 'A' at the three prime end of each strand to generate ends line in the 1a73 structure.
In order to use with straight B-form DNA, I needed to get unremediated pdb file for 1a73 or completely alter the order and chain designations to match. I felt the unremediated file was the easiest route to go.
