We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

3iv5

From Proteopedia

Revision as of 06:08, 9 September 2009 by OCA (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Unreleased structure

The entry 3iv5 is ON HOLD until sometime in the future

Authors: Stella, Stefano, Cascio, Duilio, Johnson, Reid C.

Description: Crystal structure of Fis bound to 27bp consensus sequence DNA F1(AAATTTGTTTGAATTTTGAGCAAATTT)

Page seeded by OCA on Wed Sep 9 09:08:12 2009

Proteopedia Page Contributors and Editors (what is this?)

OCA

Personal tools