6gh0
From Proteopedia
Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure
Structural highlights
Publication Abstract from PubMedIn the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10*C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression. Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.,Kotar A, Rigo R, Sissi C, Plavec J Nucleic Acids Res. 2018 Dec 21. pii: 5257350. doi: 10.1093/nar/gky1269. PMID:30590801[1] From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine. References
| ||||||||||||||||
Categories: Large Structures | Kotar, A | Plavec, J | Rigo, R | Sissi, C | C-kit promoter | Dna | G-quadruplex | Two g-quartet
