We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

Search results

From Proteopedia

You searched for Rohs,_P.D.A

Jump to: navigation, search

There is no page with the exact title "Rohs,_P.D.A". The search results for "Rohs,_P.D.A" are displayed below. You can create a page titled Rohs,_P.D.A (by clicking on the red link).

For more information about searching Proteopedia, see Help.

To exclude pages titled with 4-character PDB codes, use the checkbox "only Human created pages" at the bottom of this page.

Showing below up to 20 results starting with #1.


View (previous 20) (next 20) (20 | 50 | 100 | 250 | 500)

Article title matches

  1. User:Remo Rohs (530 bytes)
    1: [[Image:Remo_Proteopedia.jpg]]
    3: ...ate specific interactions between nucleic acids and proteins.
    5: ...e Rohs Lab at the University of Southern California]
    7: ...ty.cfm?pid=1033799 Faculty Profile Professor Remo Rohs]
  2. Category:Rohs, P D.A (42 bytes)
    1: List of pages with the keyword Rohs, P D.A
  3. Category:Rohs PDA (39 bytes)
    1: List of pages with the keyword Rohs PDA
  4. Category:Rohs R (37 bytes)
    1: List of pages with the keyword Rohs R

Page text matches

  1. Research Groups, Institutes & Programs (648 bytes)
    1: ...groups, programs or institutes related to structural biology.
    3: ...rogram, University of Massachusetts, Amherst MA USA]]
    4: *[[Fadel A. Samatey Group]]
    5: ... Clinical Biochemistry]], University of Oslo, Norway.
    6: ...otein Complexes]], a consortium of multiple European institutions.
  2. 4ibv (9,498 bytes)
    2: ...utation S240R in sequence-specific complex with DNA==
    3: ...caption='[[4ibv]], [[Resolution|resolution]] 2.10Å' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBV FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 2.1&amp;#8491;</td></tr>
  3. 4ibw (9,500 bytes)
    2: ...utation T284R in sequence-specific complex with DNA==
    3: ...caption='[[4ibw]], [[Resolution|resolution]] 1.79&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBW FirstGlance]. <br>
    6: ...raction, [[Resolution|Resolution]] 1.791&amp;#8491;</td></tr>
  4. 4iby (9,461 bytes)
    2: ...spot mutation R273H and second-site suppressor mutation S240R==
    3: ...caption='[[4iby]], [[Resolution|resolution]] 1.45&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBY FirstGlance]. <br>
    6: ...fraction, [[Resolution|Resolution]] 1.45&amp;#8491;</td></tr>
  5. 4ibz (9,514 bytes)
    2: ...spot mutation R273C and second-site suppressor mutation T284R==
    3: ...caption='[[4ibz]], [[Resolution|resolution]] 1.92&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBZ FirstGlance]. <br>
    6: ...fraction, [[Resolution|Resolution]] 1.92&amp;#8491;</td></tr>
  6. 4ijt (9,501 bytes)
    2: ==Human p53 core domain with hot spot mutation R273H (form II)==
    3: ...caption='[[4ijt]], [[Resolution|resolution]] 1.78&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IJT FirstGlance]. <br>
    6: ...fraction, [[Resolution|Resolution]] 1.78&amp;#8491;</td></tr>
  7. 4ihv (3,071 bytes)
    2: ...to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)==
    3: ...caption='[[4ihv]], [[Resolution|resolution]] 2.72&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br>
    6: ...raction, [[Resolution|Resolution]] 2.716&amp;#8491;</td></tr>
  8. 4ihw (3,083 bytes)
    2: ...ne substituted DNA F28-dI (AAATTTGTTTGAICITTGAGCAAATTT)==
    3: ...caption='[[4ihw]], [[Resolution|resolution]] 2.70&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IHW FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 2.7&amp;#8491;</td></tr>
  9. 4ibs (9,428 bytes)
    2: ==Human p53 core domain with hot spot mutation R273H (form I)==
    3: ...caption='[[4ibs]], [[Resolution|resolution]] 1.78&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBS FirstGlance]. <br>
    6: ...fraction, [[Resolution|Resolution]] 1.78&amp;#8491;</td></tr>
  10. 4ibt (9,404 bytes)
    2: ...spot mutation R273H and second-site suppressor mutation T284R==
    3: ...caption='[[4ibt]], [[Resolution|resolution]] 1.70&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBT FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 1.7&amp;#8491;</td></tr>
  11. 4ibu (9,551 bytes)
    2: ...utation T284R in sequence-specific complex with DNA==
    3: ...caption='[[4ibu]], [[Resolution|resolution]] 1.70&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBU FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 1.7&amp;#8491;</td></tr>
  12. 4ibq (9,471 bytes)
    2: ==Human p53 core domain with hot spot mutation R273C==
    3: ...caption='[[4ibq]], [[Resolution|resolution]] 1.80&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBQ FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 1.8&amp;#8491;</td></tr>
  13. 4ihx (3,305 bytes)
    2: ...e substituted DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT)==
    3: ...caption='[[4ihx]], [[Resolution|resolution]] 2.80&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IHX FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 2.8&amp;#8491;</td></tr>
  14. 4ihy (3,082 bytes)
    2: ...ne substituted DNA F29-dI (AAATTTGTTTGIICICTGAGCAAATTT)==
    3: ...caption='[[4ihy]], [[Resolution|resolution]] 2.90&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IHY FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 2.9&amp;#8491;</td></tr>
  15. 2r5y (4,593 bytes)
    2: ...ure of Scr/Exd complex bound to a consensus Hox-Exd site==
    3: ...caption='[[2r5y]], [[Resolution|resolution]] 2.60&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=2R5Y FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 2.6&amp;#8491;</td></tr>
  16. 2r5z (4,609 bytes)
    2: ... of Scr/Exd complex bound to a DNA sequence derived from the fkh gene==
    3: ...caption='[[2r5z]], [[Resolution|resolution]] 2.60&amp;Aring;' scene=''>
    4: == Structural highlights ==
    5: ...tps://proteopedia.org/fgij/fg.htm?mol=2R5Z FirstGlance]. <br>
    6: ...ffraction, [[Resolution|Resolution]] 2.6&amp;#8491;</td></tr>
  17. Student Projects (6,606 bytes)
    1: ...function of your browser (Windows: Ctrl-F; Mac: Cmd-F).
    5: ...s. Student contributors are acknowledged on each page.
    7: ...trahydrofolate reductase]] and [[Thymidylate synthase]].
    11: ...the page [[Tutorial:The opioid receptor, a molecular switch]].
    13: ...English abstract. Published also as http://hdl.handle.net/10017/27238)''
  18. Proteopedia:Team (2,499 bytes)
    1: ==The Proteopedia Team==
    2: ===Proteopedia Founders &amp; Developers===
    3: <gallery perrow="3">
    4: ...User:Jaime_Prilusky|Jaime Prilusky]]<br>'''Co-Founder'''
    5: ...d.png|[[User:Eran_Hodis|Eran Hodis]]<br>'''Co-Founder'''
  19. Lac repressor (19,557 bytes)
    2: ...de='right' scene='Morphs/1osl_19_1l1m_9_morph/2' caption=''>
    3: ...rph]] of the '''lac repressor''' complexed with DNA
    5: ...g interactive model: {{Template:Button Toggle Animation2}}
    6: ...xisting kink, is unknown. [[#Specific Binding| Details Below]].
    8: ==What is the lac repressor?==
  20. High school teachers' resources (9,171 bytes)
    1: [[Image:Dna_rotating.gif|left]]
    2: ...l model designed by a [[Group:SMART:Teams|SMART Team]].]]
    3: ..._(education) K-12]), or older students including adults.
    6: {| class="wikitable" style="background-color:#d0ffc0;"
    7: | align="center"|&amp;nbsp; [http://highschool.molviz.org...

View (previous 20) (next 20) (20 | 50 | 100 | 250 | 500)



Search in namespaces:

Include only Seeded (Automatic) pages - only Human created pages
List redirects
Search for

You may also try
Views
Personal tools