We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
Search results
From Proteopedia
You searched for Rohs,_P.D.A
There is no page with the exact title "Rohs,_P.D.A". The search results for "Rohs,_P.D.A" are displayed below. You can create a page titled Rohs,_P.D.A (by clicking on the red link).
For more information about searching Proteopedia, see Help.
To exclude pages titled with 4-character PDB codes, use the checkbox "only Human created pages" at the bottom of this page.
Showing below up to 20 results starting with #1.
View (previous 20) (next 20) (20 | 50 | 100 | 250 | 500)
Article title matches
- User:Remo Rohs (530 bytes)
1: [[Image:Remo_Proteopedia.jpg]]
3: ...ate specific interactions between nucleic acids and proteins.
5: ...e Rohs Lab at the University of Southern California]
7: ...ty.cfm?pid=1033799 Faculty Profile Professor Remo Rohs] - Category:Rohs, P D.A (42 bytes)
1: List of pages with the keyword Rohs, P D.A - Category:Rohs PDA (39 bytes)
1: List of pages with the keyword Rohs PDA - Category:Rohs R (37 bytes)
1: List of pages with the keyword Rohs R
Page text matches
- Research Groups, Institutes & Programs (648 bytes)
1: ...groups, programs or institutes related to structural biology.
3: ...rogram, University of Massachusetts, Amherst MA USA]]
4: *[[Fadel A. Samatey Group]]
5: ... Clinical Biochemistry]], University of Oslo, Norway.
6: ...otein Complexes]], a consortium of multiple European institutions. - 4ibv (9,498 bytes)
2: ...utation S240R in sequence-specific complex with DNA==
3: ...caption='[[4ibv]], [[Resolution|resolution]] 2.10Å' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBV FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 2.1&#8491;</td></tr> - 4ibw (9,500 bytes)
2: ...utation T284R in sequence-specific complex with DNA==
3: ...caption='[[4ibw]], [[Resolution|resolution]] 1.79&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBW FirstGlance]. <br>
6: ...raction, [[Resolution|Resolution]] 1.791&#8491;</td></tr> - 4iby (9,461 bytes)
2: ...spot mutation R273H and second-site suppressor mutation S240R==
3: ...caption='[[4iby]], [[Resolution|resolution]] 1.45&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBY FirstGlance]. <br>
6: ...fraction, [[Resolution|Resolution]] 1.45&#8491;</td></tr> - 4ibz (9,514 bytes)
2: ...spot mutation R273C and second-site suppressor mutation T284R==
3: ...caption='[[4ibz]], [[Resolution|resolution]] 1.92&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBZ FirstGlance]. <br>
6: ...fraction, [[Resolution|Resolution]] 1.92&#8491;</td></tr> - 4ijt (9,501 bytes)
2: ==Human p53 core domain with hot spot mutation R273H (form II)==
3: ...caption='[[4ijt]], [[Resolution|resolution]] 1.78&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IJT FirstGlance]. <br>
6: ...fraction, [[Resolution|Resolution]] 1.78&#8491;</td></tr> - 4ihv (3,071 bytes)
2: ...to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)==
3: ...caption='[[4ihv]], [[Resolution|resolution]] 2.72&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br>
6: ...raction, [[Resolution|Resolution]] 2.716&#8491;</td></tr> - 4ihw (3,083 bytes)
2: ...ne substituted DNA F28-dI (AAATTTGTTTGAICITTGAGCAAATTT)==
3: ...caption='[[4ihw]], [[Resolution|resolution]] 2.70&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IHW FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 2.7&#8491;</td></tr> - 4ibs (9,428 bytes)
2: ==Human p53 core domain with hot spot mutation R273H (form I)==
3: ...caption='[[4ibs]], [[Resolution|resolution]] 1.78&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBS FirstGlance]. <br>
6: ...fraction, [[Resolution|Resolution]] 1.78&#8491;</td></tr> - 4ibt (9,404 bytes)
2: ...spot mutation R273H and second-site suppressor mutation T284R==
3: ...caption='[[4ibt]], [[Resolution|resolution]] 1.70&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBT FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 1.7&#8491;</td></tr> - 4ibu (9,551 bytes)
2: ...utation T284R in sequence-specific complex with DNA==
3: ...caption='[[4ibu]], [[Resolution|resolution]] 1.70&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBU FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 1.7&#8491;</td></tr> - 4ibq (9,471 bytes)
2: ==Human p53 core domain with hot spot mutation R273C==
3: ...caption='[[4ibq]], [[Resolution|resolution]] 1.80&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IBQ FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 1.8&#8491;</td></tr> - 4ihx (3,305 bytes)
2: ...e substituted DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT)==
3: ...caption='[[4ihx]], [[Resolution|resolution]] 2.80&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IHX FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 2.8&#8491;</td></tr> - 4ihy (3,082 bytes)
2: ...ne substituted DNA F29-dI (AAATTTGTTTGIICICTGAGCAAATTT)==
3: ...caption='[[4ihy]], [[Resolution|resolution]] 2.90&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=4IHY FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 2.9&#8491;</td></tr> - 2r5y (4,593 bytes)
2: ...ure of Scr/Exd complex bound to a consensus Hox-Exd site==
3: ...caption='[[2r5y]], [[Resolution|resolution]] 2.60&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=2R5Y FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 2.6&#8491;</td></tr> - 2r5z (4,609 bytes)
2: ... of Scr/Exd complex bound to a DNA sequence derived from the fkh gene==
3: ...caption='[[2r5z]], [[Resolution|resolution]] 2.60&Aring;' scene=''>
4: == Structural highlights ==
5: ...tps://proteopedia.org/fgij/fg.htm?mol=2R5Z FirstGlance]. <br>
6: ...ffraction, [[Resolution|Resolution]] 2.6&#8491;</td></tr> - Student Projects (6,606 bytes)
1: ...function of your browser (Windows: Ctrl-F; Mac: Cmd-F).
5: ...s. Student contributors are acknowledged on each page.
7: ...trahydrofolate reductase]] and [[Thymidylate synthase]].
11: ...the page [[Tutorial:The opioid receptor, a molecular switch]].
13: ...English abstract. Published also as http://hdl.handle.net/10017/27238)'' - Proteopedia:Team (2,499 bytes)
1: ==The Proteopedia Team==
2: ===Proteopedia Founders & Developers===
3: <gallery perrow="3">
4: ...User:Jaime_Prilusky|Jaime Prilusky]]<br>'''Co-Founder'''
5: ...d.png|[[User:Eran_Hodis|Eran Hodis]]<br>'''Co-Founder''' - Lac repressor (19,557 bytes)
2: ...de='right' scene='Morphs/1osl_19_1l1m_9_morph/2' caption=''>
3: ...rph]] of the '''lac repressor''' complexed with DNA
5: ...g interactive model: {{Template:Button Toggle Animation2}}
6: ...xisting kink, is unknown. [[#Specific Binding| Details Below]].
8: ==What is the lac repressor?== - High school teachers' resources (9,171 bytes)
1: [[Image:Dna_rotating.gif|left]]
2: ...l model designed by a [[Group:SMART:Teams|SMART Team]].]]
3: ..._(education) K-12]), or older students including adults.
6: {| class="wikitable" style="background-color:#d0ffc0;"
7: | align="center"|&nbsp; [http://highschool.molviz.org...
View (previous 20) (next 20) (20 | 50 | 100 | 250 | 500)
You may also try
