We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
Sandbox Reserved 1120
From Proteopedia
(Difference between revisions)
(nd) |
m |
||
| Line 35: | Line 35: | ||
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That's means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. | The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosom] in the short arm (p) 11.3. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That's means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. | ||
| - | >gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]<ref> | + | >gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]</ref> |
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT | TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT | ||
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA | TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA | ||
| Line 51: | Line 51: | ||
In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. the linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1 and WT 1 (Wilms tumor). | In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. the linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1 and WT 1 (Wilms tumor). | ||
| - | <ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]<ref> | + | <ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref> |
Revision as of 19:59, 27 January 2016
| This Sandbox is Reserved from 15/12/2015, through 15/06/2016 for use in the course "Structural Biology" taught by Bruno Kieffer at the University of Strasbourg, ESBS. This reservation includes Sandbox Reserved 1120 through Sandbox Reserved 1159. |
To get started:
More help: Help:Editing |
SRY protein (AKA TDF protein)
| |||||||||||
References
- ↑ Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
- ↑ Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [1]
- ↑ Bridges CB. TRIPLOID INTERSEXES IN DROSOPHILA MELANOGASTER. Science. 1921 Sep 16;54(1394):252-4. PMID:17769897 doi:http://dx.doi.org/10.1126/science.54.1394.252
- ↑ Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
- ↑ Jost A. Becoming a male. Adv Biosci. 1973;10:3-13. PMID:4805859
- ↑ Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
- ↑ Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature. 1990 Jul 19;346(6281):245-50. PMID:2374589 doi:http://dx.doi.org/10.1038/346245a0
- ↑ Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf AM, Lovell-Badge R, Goodfellow PN. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature. 1990 Jul 19;346(6281):240-4. PMID:1695712 doi:http://dx.doi.org/10.1038/346240a0
- ↑ Werner MH, Huth JR, Gronenborn AM, Clore GM. Molecular basis of human 46X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell. 1995 Jun 2;81(5):705-14. PMID:7774012
- ↑ [2]
- ↑ Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [3]
- ↑ Werner MH, Huth JR, Gronenborn AM, Clore GM. Molecular basis of human 46X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell. 1995 Jun 2;81(5):705-14. PMID:7774012
- ↑ Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
