We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.

Sandbox Reserved 1120

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
(Image)
Line 36: Line 36:
===Sequence of the SRY gene===
===Sequence of the SRY gene===
-
 
+
<div style="width: 200px; padding-top: 50px; padding-bottom: 50px;border: 3px solid #A0A0A0; text-align: center;background: #C0C0C0;">
>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]</ref>
>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]</ref>
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT
Line 51: Line 51:
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT
GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA
CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA
 +
</div>
'''legend of bold '''
'''legend of bold '''

Revision as of 09:39, 28 January 2016

This Sandbox is Reserved from 15/12/2015, through 15/06/2016 for use in the course "Structural Biology" taught by Bruno Kieffer at the University of Strasbourg, ESBS. This reservation includes Sandbox Reserved 1120 through Sandbox Reserved 1159.
To get started:
  • Click the edit this page tab at the top. Save the page after each step, then edit it again.
  • Click the 3D button (when editing, above the wikitext box) to insert Jmol.
  • show the Scene authoring tools, create a molecular scene, and save it. Copy the green link into the page.
  • Add a description of your scene. Use the buttons above the wikitext box for bold, italics, links, headlines, etc.

More help: Help:Editing

SRY protein (AKA TDF protein)

The SRY protein linked to DNA

Drag the structure with the mouse to rotate

References

Genetic Home reference

  1. Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
  2. Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [1]
  3. Bridges CB. TRIPLOID INTERSEXES IN DROSOPHILA MELANOGASTER. Science. 1921 Sep 16;54(1394):252-4. PMID:17769897 doi:http://dx.doi.org/10.1126/science.54.1394.252
  4. Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
  5. Jost A. Becoming a male. Adv Biosci. 1973;10:3-13. PMID:4805859
  6. Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
  7. Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature. 1990 Jul 19;346(6281):245-50. PMID:2374589 doi:http://dx.doi.org/10.1038/346245a0
  8. Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf AM, Lovell-Badge R, Goodfellow PN. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature. 1990 Jul 19;346(6281):240-4. PMID:1695712 doi:http://dx.doi.org/10.1038/346240a0
  9. Werner MH, Huth JR, Gronenborn AM, Clore GM. Molecular basis of human 46X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell. 1995 Jun 2;81(5):705-14. PMID:7774012
  10. [2]
  11. McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [3]
  12. Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32
  13. [4]
  14. Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [5]
  15. Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205.
  16. Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [6]
  17. McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [7]
  18. NCBI [8]
  19. [9]
  20. Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [10]
  21. Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
  22. Murphy EC, Zhurkin VB, Louis JM, Cornilescu G, Clore GM. Structural basis for SRY-dependent 46-X,Y sex reversal: modulation of DNA bending by a naturally occurring point mutation. J Mol Biol. 2001 Sep 21;312(3):481-99. PMID:11563911 doi:http://dx.doi.org/10.1006/jmbi.2001.4977
  23. de la Chapelle A. Analytic review: nature and origin of males with XX sex chromosomes. Am J Hum Genet. 1972 Jan;24(1):71-105. PMID:4622299
Personal tools