We apologize for Proteopedia being slow to respond. For the past two years, a new implementation of Proteopedia has been being built. Soon, it will replace this 18-year old system. All existing content will be moved to the new system at a date that will be announced here.
Sandbox Reserved 1120
From Proteopedia
(Difference between revisions)
| Line 38: | Line 38: | ||
<center><div style="width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;"><small> | <center><div style="width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;"><small> | ||
>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]</ref> | >gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]</ref> | ||
| - | TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA | + | TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA<FONT color="green"><b>ATG</b></FONT>CAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAATATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAACGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC'''TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG |
| - | <FONT color="green"><b>ATG</b></FONT> | + | '''GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG'''CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA'''CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA |
| - | + | TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTACAGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACGCAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTG<FONT color="red"><b>TAG</b></FONT>GACAATCGGGTAACATTGGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA</small> | |
| - | + | ||
| - | '''TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG | + | |
| - | '''GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG | + | |
| - | '''CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGA'''CCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA | + | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
(Legend : <FONT color="green"><b>Initiation codon</b></FONT> ; <b>HMG sequence</b> ; <FONT color="red"><b>Stop codon</b></FONT>) | (Legend : <FONT color="green"><b>Initiation codon</b></FONT> ; <b>HMG sequence</b> ; <FONT color="red"><b>Stop codon</b></FONT>) | ||
Revision as of 10:30, 28 January 2016
| This Sandbox is Reserved from 15/12/2015, through 15/06/2016 for use in the course "Structural Biology" taught by Bruno Kieffer at the University of Strasbourg, ESBS. This reservation includes Sandbox Reserved 1120 through Sandbox Reserved 1159. |
To get started:
More help: Help:Editing |
SRY protein (AKA TDF protein)
| |||||||||||
References
- ↑ Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
- ↑ Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [1]
- ↑ Bridges CB. TRIPLOID INTERSEXES IN DROSOPHILA MELANOGASTER. Science. 1921 Sep 16;54(1394):252-4. PMID:17769897 doi:http://dx.doi.org/10.1126/science.54.1394.252
- ↑ Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
- ↑ Jost A. Becoming a male. Adv Biosci. 1973;10:3-13. PMID:4805859
- ↑ Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
- ↑ Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature. 1990 Jul 19;346(6281):245-50. PMID:2374589 doi:http://dx.doi.org/10.1038/346245a0
- ↑ Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf AM, Lovell-Badge R, Goodfellow PN. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature. 1990 Jul 19;346(6281):240-4. PMID:1695712 doi:http://dx.doi.org/10.1038/346240a0
- ↑ Werner MH, Huth JR, Gronenborn AM, Clore GM. Molecular basis of human 46X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell. 1995 Jun 2;81(5):705-14. PMID:7774012
- ↑ [2]
- ↑ McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [3]
- ↑ Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32
- ↑ [4]
- ↑ Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [5]
- ↑ Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205.
- ↑ Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [6]
- ↑ McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [7]
- ↑ NCBI [8]
- ↑ [9]
- ↑ Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [10]
- ↑ Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
- ↑ Murphy EC, Zhurkin VB, Louis JM, Cornilescu G, Clore GM. Structural basis for SRY-dependent 46-X,Y sex reversal: modulation of DNA bending by a naturally occurring point mutation. J Mol Biol. 2001 Sep 21;312(3):481-99. PMID:11563911 doi:http://dx.doi.org/10.1006/jmbi.2001.4977
- ↑ de la Chapelle A. Analytic review: nature and origin of males with XX sex chromosomes. Am J Hum Genet. 1972 Jan;24(1):71-105. PMID:4622299
