This old version of Proteopedia is provided for student assignments while the new version is undergoing repairs. Content and edits done in this old version of Proteopedia after March 1, 2026 will eventually be lost when it is retired in about June of 2026.


Apply for new accounts at the new Proteopedia. Your logins will work in both the old and new versions.


Sandbox Reserved 1120

From Proteopedia

(Difference between revisions)
Jump to: navigation, search
Line 38: Line 38:
==SRY gene==
==SRY gene==
-
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 <ref>[http://www.ncbi.nlm.nih.gov/gene/6736]</ref>. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein<ref> McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]</ref>. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene<ref> Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 </ref>.
+
The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor that induces the male phenotype in the embryo. The SRY gene is located on the [https://en.wikipedia.org/wiki/Y_chromosome Y chromosome] in the short arm (p) 11.3 <ref>[http://www.ncbi.nlm.nih.gov/gene/6736 NCBI gene]</ref>. This gene has only one exon that contains the HMG domain (DNA-binding High-Mobility Group box domain). It means that SRY mRNA does not have an alternative splicing, so there is only one isoforme of SRY protein<ref> McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]</ref>. Moreover, the human genome contains only one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene<ref> Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32 </ref>.
===Sequence of the SRY gene===
===Sequence of the SRY gene===
<center><div style="width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;"><small>
<center><div style="width:90%; padding-top: 10px; padding-bottom: 10px;border: 1px dashed #A0A0A0; text-align: center;background: #DCFEDA;"><small>
-
>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore]</ref>
+
>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly <ref>[http://www.ncbi.nlm.nih.gov/nuccore NCBI nucleotide]</ref>
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT
TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA
TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA
Line 122: Line 122:
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus<ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref>.
The SRY protein contains nuclear localization signals in N and C terminals. An acetylation of these domains allows the exportation of the SRY protein to the nucleus<ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref>.
-
The SRY protein activates the ''SOX9'' (SRY-box9) gene <ref> McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]</ref>. This gene is found in long arm 24.3 of the chromosome 17<ref> NCBI [http://www.ncbi.nlm.nih.gov/gene/6662] </ref> and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.
+
The SRY protein activates the ''SOX9'' (SRY-box9) gene <ref> McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [http://www.ncbi.nlm.nih.gov/pubmed/8575930]</ref>. This gene is found in long arm 24.3 of the chromosome 17<ref> NCBI [http://www.ncbi.nlm.nih.gov/gene/6662 NCBI gene: SOX9 SRY-BOX9 Homo sapiens] </ref> and is implicated in the stimulation of the differentiation of pre-Sertori into Sertoli cells rather than granulosa cells.
-
The activation of ''SOX''9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of ''SOX9'' core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the ''SOX9'' promoter. The SOX9 protein activates the gene ''AMH'' (Anti-Mullerian Hormone)<ref>[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH] </ref>. Therefore, it allows the degeneration of the channels of Müller in male. <ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87 [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref>.
+
The activation of ''SOX''9 is done by the SRY protein and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bound on an enhancer called: TESCO (Testis-Specific Enhancer of ''SOX9'' core element). The binding of a transcriptional factor on an enhancer provokes a curvature of the DNA (≈75°), allowing a stabilization of the elongation complex on the ''SOX9'' promoter. The SOX9 protein activates the gene ''AMH'' (Anti-Mullerian Hormone)<ref>[http://www.ebi.ac.uk/interpro/entry/IPR006799?q=AMH EBI-Interpro: Anti-Mullerian-Hormon, N-term] </ref>. Therefore, it allows the degeneration of the channels of Müller in male. <ref>Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87 [http://press.endocrine.org/doi/10.1210/er.2002-0025?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub%3Dpubmed&]</ref>.
===Cathecolamines regulation===
===Cathecolamines regulation===

Revision as of 22:56, 29 January 2016

This Sandbox is Reserved from 15/12/2015, through 15/06/2016 for use in the course "Structural Biology" taught by Bruno Kieffer at the University of Strasbourg, ESBS. This reservation includes Sandbox Reserved 1120 through Sandbox Reserved 1159.
To get started:
  • Click the edit this page tab at the top. Save the page after each step, then edit it again.
  • Click the 3D button (when editing, above the wikitext box) to insert Jmol.
  • show the Scene authoring tools, create a molecular scene, and save it. Copy the green link into the page.
  • Add a description of your scene. Use the buttons above the wikitext box for bold, italics, links, headlines, etc.

More help: Help:Editing

SRY protein (AKA TDF protein)

The SRY protein linked to DNA

Drag the structure with the mouse to rotate

References

Genetic Home reference

  1. Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
  2. Sumner, A. T. Sex Chromosomes and Sex Determination. Chromosomes: Organization and Function, 97-108. [1]
  3. Bridges CB. TRIPLOID INTERSEXES IN DROSOPHILA MELANOGASTER. Science. 1921 Sep 16;54(1394):252-4. PMID:17769897 doi:http://dx.doi.org/10.1126/science.54.1394.252
  4. Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
  5. Jost A. Becoming a male. Adv Biosci. 1973;10:3-13. PMID:4805859
  6. Goodfellow PN, Darling SM. Genetics of sex determination in man and mouse. Development. 1988 Feb;102(2):251-8. PMID:3046910
  7. Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature. 1990 Jul 19;346(6281):245-50. PMID:2374589 doi:http://dx.doi.org/10.1038/346245a0
  8. Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf AM, Lovell-Badge R, Goodfellow PN. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature. 1990 Jul 19;346(6281):240-4. PMID:1695712 doi:http://dx.doi.org/10.1038/346240a0
  9. Werner MH, Huth JR, Gronenborn AM, Clore GM. Molecular basis of human 46X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell. 1995 Jun 2;81(5):705-14. PMID:7774012
  10. NCBI gene
  11. McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [2]
  12. Sekido R, Lovell-Badge R. Genetic control of testis development. Sex Dev Genet Mol Biol Evol Endocrinol Embryol Pathol Sex Determ Differ. 2013;7(1-3):21–32
  13. NCBI nucleotide
  14. Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [3]
  15. Larney C, Bailey TL, Koopman P. Switching on sex: transcriptional regulation of the testis-determining gene Sry. Dev Camb Engl. 2014 Jun;141(11):2195–205
  16. Tang Y, Nilsson L. Interaction of human SRY protein with DNA: a molecular dynamics study. Proteins. 1998 Jun 1;31(4):417-33. PMID:9626701
  17. Murphy EC, Zhurkin VB, Louis JM, Cornilescu G, Clore GM. Structural basis for SRY-dependent 46-X,Y sex reversal: modulation of DNA bending by a naturally occurring point mutation. J Mol Biol. 2001 Sep 21;312(3):481-99. PMID:11563911 doi:http://dx.doi.org/10.1006/jmbi.2001.4977
  18. Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87. [4]
  19. McElreavey K, Barbaux S, Ion A, Fellous M. The genetic basis of murine and human sex determination: a review. Heredity. 1995 Dec;75 ( Pt 6):599–611. [5]
  20. NCBI NCBI gene: SOX9 SRY-BOX9 Homo sapiens
  21. EBI-Interpro: Anti-Mullerian-Hormon, N-term
  22. Harley VR, Clarkson MJ, Argentaro A. The Molecular Action and Regulation of the Testis-Determining Factors, SRY (Sex-Determining Region on the Y Chromosome) and SOX9 [SRY-Related High-Mobility Group (HMG) Box 9]. Endocr Rev. 2003 Aug 1;24(4):466–87 [6]
  23. Veitia RA. Of adrenaline and SRY in males (comment on DOI 10.1002/bies.201100159). Bioessays. 2014 May;36(5):438. doi: 10.1002/bies.201400026. Epub 2014 Mar 7. PMID:24604382 doi:http://dx.doi.org/10.1002/bies.201400026
  24. Veitia RA. Of adrenaline and SRY in males (comment on DOI 10.1002/bies.201100159). Bioessays. 2014 May;36(5):438. doi: 10.1002/bies.201400026. Epub 2014 Mar 7. PMID:24604382 doi:http://dx.doi.org/10.1002/bies.201400026
  25. Cohen, Tamara. The 'macho' gene that makes men behave aggressively has been found. The Daily Mail (2012). [7]
  26. Prokop JW, Watanabe IK, Turner ME, Underwood AC, Martins AS, Milsted A. From rat to human: regulation of Renin-Angiotensin system genes by sry. Int J Hypertens. 2012;2012:724240. doi: 10.1155/2012/724240. Epub 2012 Jan 22. PMID:22315667 doi:http://dx.doi.org/10.1155/2012/724240
  27. de la Chapelle A. Analytic review: nature and origin of males with XX sex chromosomes. Am J Hum Genet. 1972 Jan;24(1):71-105. PMID:4622299
  28. Xue TC, Zhang L, Ren ZG, Chen RX, Cui JF, Ge NL, Ye SL. Sex-determination gene SRY potentially associates with poor prognosis but not sex bias in hepatocellular carcinoma. Dig Dis Sci. 2015 Feb;60(2):427-35. doi: 10.1007/s10620-014-3377-y. Epub 2014 Oct, 2. PMID:25274159 doi:http://dx.doi.org/10.1007/s10620-014-3377-y
Personal tools