Sandbox Reserved 1120

The SRY protein is a 223 residues long monomeric polypeptide ^[1]. It is a transcriptionnal factor, It activates the Müllerian Inhibiting Substance (MIS gene). It is encoded by the testis-determining sex gene and is itself involved in the sex determination in mammels by being responsible for the male sexual developement.

History

After centuries of unfounded theories mainly based on environmental factors, the first molecular theory concerning the sex determination appeared in 1891. At this time, the german biologist Hermann Henking was studying sperm formation in wasps. As a chromosome which was not present in all the wasps looked different from the others, he suspected it to play a role in sex determination and called it the "X chromosome". Ten years later, Clarence Erwin McClung saw that this chromosome behaved differently during the meiosis and was only present in half the sperm cells of grasshoppers. As the main characteristic that varies in 50/50 proportions among zygotes is the sex, McClung suspected the X chromosome to be implicated in sexual development. In 1905, Nettie Stevens discovered the "Y chromosome" (and the female XX and male XY patterns) while she was counting the chromosomes of beetles under the microscope^[2]. During the next decades, a few theories were in competition. In 1921, Calvin Bridges's works on Drosophila melanogaster seemed to reveal that male characters acquisition is due to a genic balance between the genes contained in the X chromosome and those contained in the autosomes^[3]. In 1930, Ronald Fisher introduced the first Y-based control of sex theory by proposing two different models : either all the genes responsible for the male characters are located on the Y chromosome or there is a Y-located gene which regulates the expression of genes elsewhere in the genome^[4]. As Alfred Jost had shown the testosterone produced by the testis is responsible for the entire male phenotype acquisition^[5], in 1988, Peter Neville Goodfellow proposed that there is a gene (TDF in human, Tdy in mice) on the Y chromosome which drives the development of the testis.^[6] In 1990, Goodfellow's hypothesis was validated with the discovery of Tdy's localisation. This gene's product (expressed during the male gonadal development) owns an amino-acid motif showing homology to other known or putative DNA-binding domains. Tdy is therefore a transcriptional factor^[7]. The same year, the human SRY gene (accepted later as the TDF) was discovered^[8]. Three dimensional structure of the SRY protein was determined in 1995 using NMR spectroscopy^[9]

SRY gene

generality

The SRY gene encodes the SRY protein. The SRY protein is a transcriptional factor inducing the male phenotype in embryo. The SRY gene is located on the Y chromosom in the short arm (p) 11.3 ^[10]. This gene has only one exon containing the HMG domain (DNA-binding high-mobility group box domain). That's means that SRY mRNA does not have a alternative splicing, so there is one isoform of SRY protein.^[11]. Moreover,the human genome contains one copy of the SRY gene, whereas the mouse genome contains 6 copy of this gene. ^[12]

sequence of the SRY gene

>gi|568815574:c2787741-2786855 Homo sapiens chromosome Y, GRCh38.p2 Primary Assembly ^[13] TGTTGAGGGCGGAGAAATGCAAGTTTCATTACAAAAGTTAACGTAACAAAGAATCTGGTAGAAGTGAGTT TTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACA ATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTGTGCAAGAGAAT ATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTATCAGTGTGAAA CGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTCATCGTGTGGTC TCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCAGCAAGCAGCTG GGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACAGAAATTACAGG CCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATGCTGCCGAAGAA TTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACAACAGGTTGTAC AGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACCGCCCATCAACG CAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAATCGGGTAACATT GGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTTATGTTTAGTTT CAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA

legend of bole

first: initiation codon

second: HMG sequence

third: stop codon

regulation of the expression of the SRY gene

In humans, the SRY promoter is found at −408 bp to −95 bp upstream of the ATG initiation codon. Moreover, the SRY gene has enhancers at -727 pb upstream of the ATG initiation codon. the linkage between regulatory proteins and this enhancers have the property to increase the production of SRY protein. These regulatory proteins could be: SF1 (steroidogenic factor 1), SP1 and WT 1 (Wilms tumor). ^[14]

-SF1: this transcriptional factor belong to the family of nuclear hormone receptor and contains a zinc finger. The activation of this protein requires a ligand (hormone).

-SP1: this transciprional factor is a ubiquitous protein binding in site containing rich-GC sequences and implicated in the transcription of many genes. Moreover, this protein contains a zinc finger.

-WT1:this transcriptional factor transactives SRY gene, it contains a zinc finger. ^[15]

role of the SRY gene

the SRY protein is a transcription factor, which contains nuclear localization domains in N terminal and C terminal. An acetylation on these domains allows to export the protein SRY in the nucleus. ^[16]

The SRY protein activates the SOX9 (SRY-box9) gene ^[17]., this gene is found in the 17 chromosom in the long arm 24.3 ^[18] and is implicated in the stimulation of the differentiation of sertori cells. The activation of sox 9 are done with protein SRY and another transcriptional factor: SF1 (steroidogenic factor 1). These transcriptional factors are bind in an enhancers called: TESCO (testis-specific enhancer of Sox9 core element). the SOX 9 protein activates the gene AMH (anti-mullerian hormone)^[19] allows the reduction of the channels of Müller in male. ^[20]

Structure

The SRY-HMG domain (HMG-Box)

SRY-HMG stands for Sex determining Region Y - High Mobility Group domain. It is approximately 80 residues long. It mediates the binding of the protein to the minor groove of DNA. It has a Twisted L shape meaning that it has a long (28Å) and a short (22Å) arm. The HMG Box is made of 3 helices, its N-term and C-term are irregular. ^[21]. the overall Structure is stabilized by a hydrophobic core.

The interaction between the HMG-Box and DNA is specific and stable. It permits the bend of DNA (≈75°). It is mostly hydrophobic interaction. Only one molecule of water interface the Box and the DNA. the complex is stabilized by salt bridges between positive charged residues of the HMG domain and negative charged phosphates.^[22]

Even if the most important function of the HMG box is its capacity of binding DNA, it is also involved in:

• DNA bending
• DNA condensation
• Recombination
• Transcription activation
• DNA repair

There are 2 kinds of protein that contain a HMG box

• HMG1 : It is expressed in few cell types. It is found in transcription factors that contain a single HMG box. The bind to a DNA sequence is specific.
• HMG2 : Are found in all cell types and are abundant in chromatin. This proteins can contain two or more HMG boxes that can nonspecifically bind DNA.

General structure of SRY

3 domains:

• N-term domain
• Central domain : DNA binding (HMG box)
• C-term domain

Structure of the DNA target site

The DNA target site is a DNA octamer : d(GCACAAAC).

Function

Sex determining

It acts like a sex determinator thanks to it transcriptionnal activity. It inhibits the developpement of female sex structure in th embryonnic individual.

Implication - Future for SRY ?

Disease

It has been shown that a mutation of SRY increase male to female sex reversal for 15% REF NECESSAIRE

Relevance

Structural highlights

This is a sample scene created with SAT to by Group, and another to make of the protein. You can make your own scenes on SAT starting from scratch or loading and editing one of these sample scenes.